The Premium for Hedge Fund Lockups

The Premium for Hedge Fund Lockups

Valuation and Its Discontents Derivatives 2007 Emanuel Derman Prisma Capital Partners LP & Columbia University Whats the Point of a Financial Model? In physics you predict the future. In finance, you interpolate, extrapolate in the present.

2 Right vs. True? Right is consistent. True is true. 3 Accuracy? Ross: Options pricing is the most successful theory,

not only in finance, but in all of economics. Yes, but how accurate it is? 4 The Volatility Smile S&P Smile QuickTime and a TIFF (LZW) decompressor

are needed to see this picture. BS Smile QuickTime and a TIFF (LZW) decompressor are needed to see this picture. 5

The Volatility Smile S&P Smile QuickTime and a TIFF (LZW) decompressor are needed to see this picture. BS Smile QuickTime and a

TIFF (LZW) decompressor are needed to see this picture. Vulgar models are probably the most practical. 6 The Derivatives Paradigm This is how options theory works: * pick a plausible stochastic process with parameters; * calculate the value of liquid securities whose prices you know;

* calibrate the parameters to match those prices; * use the model to calculate values of other securities. Every few years the process has been repeated for a new asset class: * stock options: match stock and bond prices, calibrate volatility; * interest rates: match bond or swap prices, calibrate volatilities; * credit: match CDS prices, calibrate future default probabilities. 7 Underlyer Trouble

QuickTime and a TIFF (LZW) decompressor are needed to see this picture. 8 Emanuel Derman Prisma Capital Partners LP

This presentation (the Presentation) is intended only for the person to whom it has been delivered. This Presentation is for discussion purposes only and is being furnished to you on a confidential basis to provide summary information regarding Prisma Capital Partners and the investment advisory services it offers. The Presentation may not be reproduced or used for any other purposes. You should not construe the contents of the Presentation as legal, tax investment or other advice. This Presentation is not an offer or solicitation with respect to the purchase or sale of any security. 9

Recently Viewed Presentations

  • The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

    The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

    What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer • Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats
  • 슬라이드 1 - mclab.silla.ac.kr

    슬라이드 1 - mclab.silla.ac.kr

    Differences from other Windows file systems No letters assigned to file systems No concept of current directory No support for overlapped I/O All files stored in Ram are automatically compressed The Filesys Module (con't) Registry Provides a common repository for...
  • Matter Unit

    Matter Unit

    KMT. The more energy the particles have, the fastertheymove and further apartthey get. KMT Explains States of Matter. Solid. Liquid. Gas. Particles are so tightly packed together they cannot move freely. They canonly vibrate.
  • Vocabulary Words World Literature Week 11 Nondescript  Bettys

    Vocabulary Words World Literature Week 11 Nondescript Bettys

    Raucous Definition: adj.—disorderly Synonym: wild, loud, boisterous, unruly Antonym: subdued Reticent Our teacher discovered that Jay 's fear of stuttering was the reason he was so reticent in class.
  • The Problem of Evil and God - Bible Truths

    The Problem of Evil and God - Bible Truths

    The Problem of Evil and God Man has always wondered regarding evil, why it happens and what, if any, role God plays in the causation process. God is the Creator (Gen. 1; 2, Acts 17: 24).
  • The next NCEP Climate Forecast System Status Hua-Lu Pan and ...

    The next NCEP Climate Forecast System Status Hua-Lu Pan and ...

    The next NCEP Climate Forecast System Status Hua-Lu Pan and Suru Saha ... Yutai Hou provided CO2 changes as well as codes to incorporate the CO2 changes Paul van Delst updated the CRTM for all the instruments Several people from...
  • Middle Ages 1 Aim: How did Charlemagne briefly

    Middle Ages 1 Aim: How did Charlemagne briefly

    "Middle Ages 1" Aim: How did Charlemagne briefly reunite much of Western Europe? Do Now: Review: What are some major themes you studied last semester?
  • Doing Business Internationally What You Need to Know ...

    Doing Business Internationally What You Need to Know ...

    Andrew J. Zeltner, Esq. Andrew J. Zeltner is an Associate in the Firm's Philadelphia office and handles a wide array of corporate immigration matters including those involving the processing of permanent resident applications (green cards) on behalf of multinational corporate...